Sorry! No results found
Please visit us back tomorrow as we add 10, 000 new research topics everyday!
About 10 results ( 0,20 seconds)
DNA are adenine, thymine, guanine, and cytosine. The sugar group that is attached to the sugar-phosphate backbone is deoxyribose. Each nucleotide will link to another corresponding nucleotide in the DNA molecule, A with G, T with C, etc. (A...
5’ – ATGCTATCATTGACCTTGAGTTATTAA – 3’ 1. Is this a strand of DNA or RNA? How do you know? DNA comprises A-T and G-C pairs. RNA comprises A,U,G,C - NO T! As a result, the demonstration is DNA. The majority cellular RNA is lone strand, where...
A. Retrovirus DNA is stably integrated in host cell DNA. However, little is known about the sites of integration and the mechanism by which viral DNA integrates into host cell DNA. Early after retrovirus infection of sensitive cells, many c...
articles were referring to the technique of RNA interference, showing the extraordinary interest that researchers carry him. The use of small interfering RNA to study gene function in mammals has become a very few years a basic technique us...
DNA. Along with the environmental variation that influences the individual encodes their phenotype. Otherwise, the genotype can be defined as the set of genes of an organism and the phenotype as the set of traits of an organism. Therefore, ...
of mRNA An Alternative Process of Post-Transcriptional Modification of mRNA In bacteria, mRNA generally does not undergo modification following transcription while tRNA is processed in bacteria with cleavage, addition, and modification. In ...
DNA of each chromosome is copied. This process is known as DNA replication. Each chromosome consists of many genes that hold the genetic information that is transferred. Indeed, it is the combination of a genetic organization that determine...